Journal: Frontiers in Pharmacology

Article Title: Bromhexine inhibits SARS-CoV-2 Omicron and variant pseudovirus infection via ACE2-targeted mechanisms

doi: 10.3389/fphar.2025.1745277

Figure Lengend Snippet: Immunofluorescence and Western blot analysis of ACE2 in HEK-293 and HEK-293/ACE2 cell lines. (A,C) Immunofluorescence localization of ACE2 proteins (red fluorescence). (B,D) Immunostaining images with primary antibodies omitted (control). All images show cell nuclei stained with DAPI (blue fluorescence). The scale bar represents 20 µm. (E) Representative immunoblots for ACE2 (90 kDa) and Actin (42 kDa) as a loading control are shown for HEK-293 cells and the stable cell line overexpressing human ACE2 (HEK-293/ACE2). (F) The relative abundance of ACE2 protein levels is expressed as the ratio of ACE2 to Actin band intensities. Data are shown as mean ± SEM from three independent experiments.

Article Snippet: Briefly, cells were seeded on coverslips, fixed with 4% paraformaldehyde (PFA) in 1x phosphate-buffered saline (PBS) for 20 min at room temperature, and permeabilized with 2% bovine serum albumin (BSA) in PBS containing 0.1% Triton X-100 for 30 min. After blocking, cells were incubated overnight at 4 °C with mouse monoclonal primary antibodies against ACE2 (1:50 dilution, sc-390851; Santa Cruz Biotechnology, Dallas, TX, United States).

Techniques: Immunofluorescence, Western Blot, Fluorescence, Immunostaining, Control, Staining, Stable Transfection

Journal: Frontiers in Pharmacology

Article Title: Bromhexine inhibits SARS-CoV-2 Omicron and variant pseudovirus infection via ACE2-targeted mechanisms

doi: 10.3389/fphar.2025.1745277

Figure Lengend Snippet: Effect of bromhexine on SARS-CoV-2 Omicron pseudovirus infectivity in HEK-293/ACE2 cells. (A,C,E) Representative fluorescence microscopy images of cells infected with Omicron pseudovirus treated with 1, 10, and 100 µM bromhexine, respectively. (B) Positive control (Omicron pseudovirus infection without bromhexine). (D) Negative control (cells without Omicron pseudovirus infection or bromhexine). (F) Quantitative analysis of Omicron pseudovirus infection in HEK-293/ACE2 cells, based on the percentage of GFP-positive cells after infection. GFP expression indicates successful pseudovirus entry. Data are presented as means ± SEM ( n = 4) from at least three different experiments. An asterisk (*) indicates statistically significant differences ( p < 0.05) compared to the positive control, determined by one-way ANOVA with post hoc Tukey HSD test.

Article Snippet: Briefly, cells were seeded on coverslips, fixed with 4% paraformaldehyde (PFA) in 1x phosphate-buffered saline (PBS) for 20 min at room temperature, and permeabilized with 2% bovine serum albumin (BSA) in PBS containing 0.1% Triton X-100 for 30 min. After blocking, cells were incubated overnight at 4 °C with mouse monoclonal primary antibodies against ACE2 (1:50 dilution, sc-390851; Santa Cruz Biotechnology, Dallas, TX, United States).

Techniques: Infection, Fluorescence, Microscopy, Positive Control, Negative Control, Expressing

Journal: Frontiers in Pharmacology

Article Title: Bromhexine inhibits SARS-CoV-2 Omicron and variant pseudovirus infection via ACE2-targeted mechanisms

doi: 10.3389/fphar.2025.1745277

Figure Lengend Snippet: Luciferase activity and IC 50 determination on HEK-293/ACE2 cells. (A) Infectivity of Omicron pseudoviruses was assessed by measuring luciferase activity in relative luminescence units (RLUs) after infecting cells with the viruses. Data are shown as means ± SEM ( n = 4). An asterisk (*) indicates statistically significant differences ( p < 0.05) determined by one-way ANOVA with post hoc Tukey HSD test. (B) Dose-response curve used to determine the half-maximal inhibitory concentration (IC 50 ) of bromhexine in HEK-293/ACE2 cells infected with Omicron pseudovirus, with an IC 50 of 17.3 ± 0.9 µM. Results are presented as means ± SEM ( n = 4). Curves are fitted to a 4-parameter logistic model and generated using the average of fitted parameters from individual experiments.

Article Snippet: Briefly, cells were seeded on coverslips, fixed with 4% paraformaldehyde (PFA) in 1x phosphate-buffered saline (PBS) for 20 min at room temperature, and permeabilized with 2% bovine serum albumin (BSA) in PBS containing 0.1% Triton X-100 for 30 min. After blocking, cells were incubated overnight at 4 °C with mouse monoclonal primary antibodies against ACE2 (1:50 dilution, sc-390851; Santa Cruz Biotechnology, Dallas, TX, United States).

Techniques: Luciferase, Activity Assay, Infection, Concentration Assay, Generated

Journal: Frontiers in Pharmacology

Article Title: Bromhexine inhibits SARS-CoV-2 Omicron and variant pseudovirus infection via ACE2-targeted mechanisms

doi: 10.3389/fphar.2025.1745277

Figure Lengend Snippet: Reduction in infectivity of SARS-CoV-2 pseudovirus variants in HEK-293/ACE2 cells treated with bromhexine. Infectivity of pseudoviruses representing Alpha, Beta, and Delta SARS-CoV-2 variants was measured by luciferase activity, expressed in relative luminescence units (RLUs), 48 h after treatment with 40 μM bromhexine or a vehicle (control). The cells were infected with pseudoviruses engineered to express each variant. Data are shown as means ± SEM ( n = 4). An asterisk (*) indicates statistically significant differences ( p < 0.05) compared to the control group, determined by two-way ANOVA followed by post hoc Tukey HSD test.

Article Snippet: Briefly, cells were seeded on coverslips, fixed with 4% paraformaldehyde (PFA) in 1x phosphate-buffered saline (PBS) for 20 min at room temperature, and permeabilized with 2% bovine serum albumin (BSA) in PBS containing 0.1% Triton X-100 for 30 min. After blocking, cells were incubated overnight at 4 °C with mouse monoclonal primary antibodies against ACE2 (1:50 dilution, sc-390851; Santa Cruz Biotechnology, Dallas, TX, United States).

Techniques: Infection, Luciferase, Activity Assay, Control, Variant Assay

Journal: Cell reports

Article Title: SARS-CoV-2 spike N-terminal domain modulates TMPRSS2-dependent viral entry and fusogenicity.

doi: 10.1016/j.celrep.2022.111220

Figure Lengend Snippet: Figure 1. SARS-CoV-2 Delta exhibits increased infectivity over Kappa in Calu3 cells and is dependent on the NTD (A) Schematic diagrams of WT (with D614G), Kappa, and Delta with their chimeras bearing swapped NTDs. The consensus mutations be- tween Kappa and Delta are annotated in blue. The monomeric spikes shown on the right-hand side are for illustration purposes. PBCS, polybasic cleavage site; RBM, receptor-binding motif; FP, fusion peptide. (B) Western blots of purified PVs bearing either H69V70 deletion or WT, Kappa, or Delta spikes. The sizes of protein markers are labeled to the left of the blot, and the corresponding bands are labeled to the right. (C and D) The intensity of the spike-associated bands on the western blots was densitometrically quantified (ImageJ) before the ratio was calculated for cleavage (C; S2/FL, paired t test) or spike sta- bility (D; S2/S1; one sample t test). In both (C) and (D), each dot represents one PV preparation. (E) PV bearing Delta, Kappa, or chimeric spike was used to transduce Calu3 and organoids express- ing endogenous levels of ACE2 and TMPRSS2 and ACE2/TMPRSS2-overexpressing cell lines including HeLa-ACE2, Vero-ACE2/TMPRSS2, and A549-ACE2/TMPRSS2. Unpaired t test. (F) PV bearing WT, WT with Kappa NTD, and WT with Delta NTD were used to transduce Calu3 cells. In (E) and (F), mean ± SEM are shown for technical replicates (n = 2–4; two-sided unpaired Student t test). Data are representative of two to four experi- ments. ns, not significant, *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001.

Article Snippet: For receptor blocking assay, 293T-ACE2DTMPRSS2 cells were treated with a series titrations of anti-ACE2 antibody (R&D systems) for 2 h. This was then followed by the addition of a comparable amount of input viruses pseudotyped with Delta, Kappa or chimeras (approx.

Techniques: Infection, Binding Assay, Western Blot, Labeling, Transduction

Journal: Cell reports

Article Title: SARS-CoV-2 spike N-terminal domain modulates TMPRSS2-dependent viral entry and fusogenicity.

doi: 10.1016/j.celrep.2022.111220

Figure Lengend Snippet: Figure 3. Reverting mutations in the Delta NTD toward WT reduces infectivity in lung cells and increases neutralization sensitivity to vaccine- elicited antibody (A) PV bearing Delta and its reversions were used to transduce Calu3 and HeLa-ACE2 cells. Mean ± SEM are shown for technical replicates (n = 4; two-sided unpaired Student’s t test). (B) Examples of neutralization curves from ID32, -63, and -105 vaccinees with PVs bearing the reversion at 142, 156, or 157/8. Data points represent the mean of two technical replicates. (C) The 50% serum neutralization was plotted across ten sera showing the geometric mean with geometric SD. Paired Wilcoxon was used for analysis. Data are representative of two experiments. ns, not significant, *p < 0.05, **p < 0.01.

Article Snippet: For receptor blocking assay, 293T-ACE2DTMPRSS2 cells were treated with a series titrations of anti-ACE2 antibody (R&D systems) for 2 h. This was then followed by the addition of a comparable amount of input viruses pseudotyped with Delta, Kappa or chimeras (approx.

Techniques: Infection, Neutralization, Transduction

Journal: Cell reports

Article Title: SARS-CoV-2 spike N-terminal domain modulates TMPRSS2-dependent viral entry and fusogenicity.

doi: 10.1016/j.celrep.2022.111220

Figure Lengend Snippet: Figure 4. The SARS-CoV-2 Delta NTD in- creases fusion kinetics of Kappa and WT spikes (A) A schematic diagram showing the split GFP system for spike-ACE2-mediated cell fusion. (B) 681R or 681H is required for the enhanced fu- sogenicity in Delta and its chimera bearing the Kappa NTD. (C) The fused Delta NTD in Kappa and WT increased the fusion kinetics of their counterparts, respectively. The line graphs on the right show the percentage of the positive GFP area at 12, 14, 16, 20, 22, and 23 h post transfection. The data showing the SEM at each time point were aver- aged from two experiments. The heatmap at each time point shows the mean of the GFP-positive area over the field of view from two experiments.

Article Snippet: For receptor blocking assay, 293T-ACE2DTMPRSS2 cells were treated with a series titrations of anti-ACE2 antibody (R&D systems) for 2 h. This was then followed by the addition of a comparable amount of input viruses pseudotyped with Delta, Kappa or chimeras (approx.

Techniques: Transfection

Journal: Cell reports

Article Title: SARS-CoV-2 spike N-terminal domain modulates TMPRSS2-dependent viral entry and fusogenicity.

doi: 10.1016/j.celrep.2022.111220

Figure Lengend Snippet: Figure 5. The SARS-CoV-2 Delta NTD or BA.2 NTD does not alter spike fusion or sensitivity to TMPRSS2 of BA.1 (A) PV bearing Delta, BA.1, BA.2, or chimeric forms of BA.1 and BA.2 spike were used to transduce Calu3, H1299, and 293T expressing endogenous levels of ACE2 and TMPRSS2 and TMPRSS2-overexpressing 293T cells. (B) Fusion kinetics of the chimeric Delta NTD in BA.1 and BA.2 along with their parental spikes. The heatmap at each time point shows the mean of the GFP- positive area over the field of view from two experiments. The western blot showing cleavage of spike is directly underneath the heatmap. (C) PV bearing BA.1, BA.2, or chimeras with Delta were transduced into either parental 293T cells or 293T cells overexpressing TMPRSS2. The fold increase of the virus entry in TMPRSS2-overexpressing cells over parental cells is shown above the scatterplots. (legend continued on next page)

Article Snippet: For receptor blocking assay, 293T-ACE2DTMPRSS2 cells were treated with a series titrations of anti-ACE2 antibody (R&D systems) for 2 h. This was then followed by the addition of a comparable amount of input viruses pseudotyped with Delta, Kappa or chimeras (approx.

Techniques: Transduction, Expressing, Western Blot, Virus

Journal: Biochemical and Biophysical Research Communications

Article Title: Susceptibility to SARS coronavirus S protein-driven infection correlates with expression of angiotensin converting enzyme 2 and infection can be blocked by soluble receptor

doi: 10.1016/j.bbrc.2004.05.114

Figure Lengend Snippet: (A) Expression of ACE2 in cell culture cell lines susceptible (+) or refractory (−) to SARS-CoV infection. Total RNA was isolated from the indicated cell lines followed by reverse transcription. Subsequently, a nested PCR with ACE2-specific oligonucleotides was performed using either the resulting cDNAs as templates (middle panel, +RT) or employing the input RNA (upper panel, −RT). As a control, all cDNAs were subjected to a PCR with GAPDH-specific oligonucleotides (lower panel). (B) Enhanced SARS-CoV S-mediated entry into 293T cells transiently over-expressing ACE2. ACE2 of human (hu) and African green monkey (agm) origin or human CD13 were transiently expressed in 293T cells followed by infection with SARS-CoV S-pseudotypes carrying a luciferase reporter gene. After 72 h, cells were lysed and luciferase activity was determined in the cell extracts. Each experiment was performed in quadruplicate and repeated at least three times with independent virus stocks.

Article Snippet: ACE2-proteins were detected using a monoclonal ACE2 antibody (R&D systems, Minneapolis).

Techniques: Expressing, Cell Culture, Infection, Isolation, Reverse Transcription, Nested PCR, Control, Luciferase, Activity Assay, Virus

Journal: Biochemical and Biophysical Research Communications

Article Title: Susceptibility to SARS coronavirus S protein-driven infection correlates with expression of angiotensin converting enzyme 2 and infection can be blocked by soluble receptor

doi: 10.1016/j.bbrc.2004.05.114

Figure Lengend Snippet: Analysis of the contribution of the ACE2 cytoplasmic domain to receptor function. (A) Schematic overview depicting the C-terminal ACE2 mutants analyzed. Putative tyrosine and casein kinase motifs are boxed. (B) Surface expression of ACE2 and the ACE2 deletion mutants. ACE2 was transiently expressed in 293T cells and analyzed by FACS using a polyclonal ACE2 antiserum followed by incubation with a polyclonal FITC-labeled secondary antibody (left panel, dark grey). As controls, pcDNA3-transfected cells were incubated with the secondary antibody (black line) or with both the ACE2-specific antiserum in combination with the secondary antibody (light grey). Similarly, the indicated ACE2 deletion mutants were subjected to FACS analysis; the percentage of ACE2 expressing cells is shown (middle panel). In parallel, expression of wild type ACE2 (lane 2) and all ACE2 mutants was examined by Western blot analysis (right panel: lane 1, pcDNA3; lane 3, mutant 1–790; lane 4, mutant 1–779; lane 5, mutant 1–775; and lane 6, mutant 1–771). (C) Role of the cytoplasmic domain within ACE2 for SARS-CoV S-mediated infection of target cells. ACE2 and the indicated deletion mutants were transiently expressed in 293T cells followed by infection with S-pseudotypes carrying luciferase as reporter gene. After 72 h, the luciferase activity was determined. Each experiment was performed in quadruplicate and repeated at least three times with independent virus preparations.

Article Snippet: ACE2-proteins were detected using a monoclonal ACE2 antibody (R&D systems, Minneapolis).

Techniques: Expressing, Incubation, Labeling, Transfection, Western Blot, Mutagenesis, Infection, Luciferase, Activity Assay, Virus

Journal: Biochemical and Biophysical Research Communications

Article Title: Susceptibility to SARS coronavirus S protein-driven infection correlates with expression of angiotensin converting enzyme 2 and infection can be blocked by soluble receptor

doi: 10.1016/j.bbrc.2004.05.114

Figure Lengend Snippet: Expression of soluble ACE2 protein and inhibition of SARS-CoV S-driven infection. (A) Expression of the soluble ACE2 ectodomain. Either a pcDNA3 control vector (lane 1), wild type ACE2 (lane 2) or an ACE2 variant comprising only the ectodomain (lane 3) was transiently expressed in 293T cells. After 48 h, cells and culture supernatants (lanes 4–6) were harvested and analyzed for ACE2 expression via Western blot. (B) Inhibition of S-mediated entry into 293T cells by soluble ACE2. S-bearing pseudotypes and VSV-G pseudotypes normalized for equal luciferase activity (10 4 c.p.s.) upon infection of target cells were pre-incubated with the indicated dilutions of concentrated soluble ACE2 and used for infection of 293T cells. Luciferase activity was determined in cell extracts after 72 h. The relative luciferase units obtained after infection in the absence of soluble ACE2 was set as 100%. Each experiment was performed in quadruplicate and repeated three times; similar results were obtained with a different soluble ACE2 preparation and with independent virus stocks.

Article Snippet: ACE2-proteins were detected using a monoclonal ACE2 antibody (R&D systems, Minneapolis).

Techniques: Expressing, Inhibition, Infection, Control, Plasmid Preparation, Variant Assay, Western Blot, Luciferase, Activity Assay, Incubation, Virus

Journal: Cell reports

Article Title: SARS-CoV-2 spike N-terminal domain modulates TMPRSS2-dependent viral entry and fusogenicity.

doi: 10.1016/j.celrep.2022.111220

Figure Lengend Snippet: Figure 1. SARS-CoV-2 Delta exhibits increased infectivity over Kappa in Calu3 cells and is dependent on the NTD (A) Schematic diagrams of WT (with D614G), Kappa, and Delta with their chimeras bearing swapped NTDs. The consensus mutations be- tween Kappa and Delta are annotated in blue. The monomeric spikes shown on the right-hand side are for illustration purposes. PBCS, polybasic cleavage site; RBM, receptor-binding motif; FP, fusion peptide. (B) Western blots of purified PVs bearing either H69V70 deletion or WT, Kappa, or Delta spikes. The sizes of protein markers are labeled to the left of the blot, and the corresponding bands are labeled to the right. (C and D) The intensity of the spike-associated bands on the western blots was densitometrically quantified (ImageJ) before the ratio was calculated for cleavage (C; S2/FL, paired t test) or spike sta- bility (D; S2/S1; one sample t test). In both (C) and (D), each dot represents one PV preparation. (E) PV bearing Delta, Kappa, or chimeric spike was used to transduce Calu3 and organoids express- ing endogenous levels of ACE2 and TMPRSS2 and ACE2/TMPRSS2-overexpressing cell lines including HeLa-ACE2, Vero-ACE2/TMPRSS2, and A549-ACE2/TMPRSS2. Unpaired t test. (F) PV bearing WT, WT with Kappa NTD, and WT with Delta NTD were used to transduce Calu3 cells. In (E) and (F), mean ± SEM are shown for technical replicates (n = 2–4; two-sided unpaired Student t test). Data are representative of two to four experi- ments. ns, not significant, *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-ACE2 antibody R&D systems Cat#AF933; RRID:AB_355722 Rabbit anti-SARS-CoV-2 S Thermofisher Cat#PA1-41165; RRID:AB_1087210 Mouse anti-SARS-CoV-2 S1 R&D systems Cat#MAB105403 Mouse anti HIV-1 p55/p24 NIBSC Cat#ARP313 Rabbit anti-GAPDH Proteintech Cat#10494-1-AP; RRID:AB_2263076 Anti-rabbit HRP conjugate Cell Signaling Cat#7074; RRID:AB_2099233 Anti-mouse HRP conjugate Cell Signaling Cat#7076; RRID:AB_330924 Goat anti-Rabbit IgG Alexa Fluor 647 Thermofisher Cat#A21244; RRID:AB_2535812 Bacterial and virus strains XL1-blue cells Agilent Cat#200249 Biological samples Airway organoids Joo-Hyeon Lee N/A Human Sera Collier et al. (2021a) N/A Chemicals, peptides, and recombinant proteins E64D Tocris Cat#4545 Camostat Sigma-Aldrich Cat#SML0057 Fugene HD Transfection Reagent Promega Cat#E2311 Fugene 6 Transfection Reagent Promega Cat#E2691 Critical commercial assays Bright-Glo Promega Cat#E2650 QuikChange Lightning Agilent Cat#210518 QuantiTect SYBR Green PCR Kit Qiagen Cat#204143 Experimental models: Cell lines HEK293T ATCC Cat#CRL-3216 HEK293T-TMPRSS2 Leo James N/A HEK293T-ACE2DTMPRSS2 Leo James N/A HEK293T-GFP11 Leo James N/A Vero-GFP1-10 Leo James N/A Vero-ACE2/TMPRSS2 Emma Thomson N/A Calu3 Paul Lehner N/A A549-ACE2/TMPRSS2 Massimo Palmarini N/A NCI-H1299 Simon Cook N/A HeLa-ACE2 James Voss N/A Oligonucleotides SARS-CoV-2_Delta_G156E_Fwd: AG CTGGATGGAAAGCGAGGTGTACAG CAGCGCCAACAACTG This paper N/A SARS-CoV-2_Delta_G156E_Rev: GC AGTTGTTGGCGCTGCTGTACACCT CGCTTTCCATCCAGCT This paper N/A SARS-CoV-2_Delta_D142G_Fwd: G CAACGACCCCTTCCTGGGCGTCTA CTACCACAAGAAC This paper N/A (Continued on next page) Cell Reports 40, 111220, August 16, 2022 e1

Techniques: Infection, Binding Assay, Western Blot, Labeling, Transduction

Journal: Cell reports

Article Title: SARS-CoV-2 spike N-terminal domain modulates TMPRSS2-dependent viral entry and fusogenicity.

doi: 10.1016/j.celrep.2022.111220

Figure Lengend Snippet: Figure 3. Reverting mutations in the Delta NTD toward WT reduces infectivity in lung cells and increases neutralization sensitivity to vaccine- elicited antibody (A) PV bearing Delta and its reversions were used to transduce Calu3 and HeLa-ACE2 cells. Mean ± SEM are shown for technical replicates (n = 4; two-sided unpaired Student’s t test). (B) Examples of neutralization curves from ID32, -63, and -105 vaccinees with PVs bearing the reversion at 142, 156, or 157/8. Data points represent the mean of two technical replicates. (C) The 50% serum neutralization was plotted across ten sera showing the geometric mean with geometric SD. Paired Wilcoxon was used for analysis. Data are representative of two experiments. ns, not significant, *p < 0.05, **p < 0.01.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-ACE2 antibody R&D systems Cat#AF933; RRID:AB_355722 Rabbit anti-SARS-CoV-2 S Thermofisher Cat#PA1-41165; RRID:AB_1087210 Mouse anti-SARS-CoV-2 S1 R&D systems Cat#MAB105403 Mouse anti HIV-1 p55/p24 NIBSC Cat#ARP313 Rabbit anti-GAPDH Proteintech Cat#10494-1-AP; RRID:AB_2263076 Anti-rabbit HRP conjugate Cell Signaling Cat#7074; RRID:AB_2099233 Anti-mouse HRP conjugate Cell Signaling Cat#7076; RRID:AB_330924 Goat anti-Rabbit IgG Alexa Fluor 647 Thermofisher Cat#A21244; RRID:AB_2535812 Bacterial and virus strains XL1-blue cells Agilent Cat#200249 Biological samples Airway organoids Joo-Hyeon Lee N/A Human Sera Collier et al. (2021a) N/A Chemicals, peptides, and recombinant proteins E64D Tocris Cat#4545 Camostat Sigma-Aldrich Cat#SML0057 Fugene HD Transfection Reagent Promega Cat#E2311 Fugene 6 Transfection Reagent Promega Cat#E2691 Critical commercial assays Bright-Glo Promega Cat#E2650 QuikChange Lightning Agilent Cat#210518 QuantiTect SYBR Green PCR Kit Qiagen Cat#204143 Experimental models: Cell lines HEK293T ATCC Cat#CRL-3216 HEK293T-TMPRSS2 Leo James N/A HEK293T-ACE2DTMPRSS2 Leo James N/A HEK293T-GFP11 Leo James N/A Vero-GFP1-10 Leo James N/A Vero-ACE2/TMPRSS2 Emma Thomson N/A Calu3 Paul Lehner N/A A549-ACE2/TMPRSS2 Massimo Palmarini N/A NCI-H1299 Simon Cook N/A HeLa-ACE2 James Voss N/A Oligonucleotides SARS-CoV-2_Delta_G156E_Fwd: AG CTGGATGGAAAGCGAGGTGTACAG CAGCGCCAACAACTG This paper N/A SARS-CoV-2_Delta_G156E_Rev: GC AGTTGTTGGCGCTGCTGTACACCT CGCTTTCCATCCAGCT This paper N/A SARS-CoV-2_Delta_D142G_Fwd: G CAACGACCCCTTCCTGGGCGTCTA CTACCACAAGAAC This paper N/A (Continued on next page) Cell Reports 40, 111220, August 16, 2022 e1

Techniques: Infection, Neutralization, Transduction

Journal: Cell reports

Article Title: SARS-CoV-2 spike N-terminal domain modulates TMPRSS2-dependent viral entry and fusogenicity.

doi: 10.1016/j.celrep.2022.111220

Figure Lengend Snippet: Figure 4. The SARS-CoV-2 Delta NTD in- creases fusion kinetics of Kappa and WT spikes (A) A schematic diagram showing the split GFP system for spike-ACE2-mediated cell fusion. (B) 681R or 681H is required for the enhanced fu- sogenicity in Delta and its chimera bearing the Kappa NTD. (C) The fused Delta NTD in Kappa and WT increased the fusion kinetics of their counterparts, respectively. The line graphs on the right show the percentage of the positive GFP area at 12, 14, 16, 20, 22, and 23 h post transfection. The data showing the SEM at each time point were aver- aged from two experiments. The heatmap at each time point shows the mean of the GFP-positive area over the field of view from two experiments.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-ACE2 antibody R&D systems Cat#AF933; RRID:AB_355722 Rabbit anti-SARS-CoV-2 S Thermofisher Cat#PA1-41165; RRID:AB_1087210 Mouse anti-SARS-CoV-2 S1 R&D systems Cat#MAB105403 Mouse anti HIV-1 p55/p24 NIBSC Cat#ARP313 Rabbit anti-GAPDH Proteintech Cat#10494-1-AP; RRID:AB_2263076 Anti-rabbit HRP conjugate Cell Signaling Cat#7074; RRID:AB_2099233 Anti-mouse HRP conjugate Cell Signaling Cat#7076; RRID:AB_330924 Goat anti-Rabbit IgG Alexa Fluor 647 Thermofisher Cat#A21244; RRID:AB_2535812 Bacterial and virus strains XL1-blue cells Agilent Cat#200249 Biological samples Airway organoids Joo-Hyeon Lee N/A Human Sera Collier et al. (2021a) N/A Chemicals, peptides, and recombinant proteins E64D Tocris Cat#4545 Camostat Sigma-Aldrich Cat#SML0057 Fugene HD Transfection Reagent Promega Cat#E2311 Fugene 6 Transfection Reagent Promega Cat#E2691 Critical commercial assays Bright-Glo Promega Cat#E2650 QuikChange Lightning Agilent Cat#210518 QuantiTect SYBR Green PCR Kit Qiagen Cat#204143 Experimental models: Cell lines HEK293T ATCC Cat#CRL-3216 HEK293T-TMPRSS2 Leo James N/A HEK293T-ACE2DTMPRSS2 Leo James N/A HEK293T-GFP11 Leo James N/A Vero-GFP1-10 Leo James N/A Vero-ACE2/TMPRSS2 Emma Thomson N/A Calu3 Paul Lehner N/A A549-ACE2/TMPRSS2 Massimo Palmarini N/A NCI-H1299 Simon Cook N/A HeLa-ACE2 James Voss N/A Oligonucleotides SARS-CoV-2_Delta_G156E_Fwd: AG CTGGATGGAAAGCGAGGTGTACAG CAGCGCCAACAACTG This paper N/A SARS-CoV-2_Delta_G156E_Rev: GC AGTTGTTGGCGCTGCTGTACACCT CGCTTTCCATCCAGCT This paper N/A SARS-CoV-2_Delta_D142G_Fwd: G CAACGACCCCTTCCTGGGCGTCTA CTACCACAAGAAC This paper N/A (Continued on next page) Cell Reports 40, 111220, August 16, 2022 e1

Techniques: Transfection

Journal: Cell reports

Article Title: SARS-CoV-2 spike N-terminal domain modulates TMPRSS2-dependent viral entry and fusogenicity.

doi: 10.1016/j.celrep.2022.111220

Figure Lengend Snippet: Figure 5. The SARS-CoV-2 Delta NTD or BA.2 NTD does not alter spike fusion or sensitivity to TMPRSS2 of BA.1 (A) PV bearing Delta, BA.1, BA.2, or chimeric forms of BA.1 and BA.2 spike were used to transduce Calu3, H1299, and 293T expressing endogenous levels of ACE2 and TMPRSS2 and TMPRSS2-overexpressing 293T cells. (B) Fusion kinetics of the chimeric Delta NTD in BA.1 and BA.2 along with their parental spikes. The heatmap at each time point shows the mean of the GFP- positive area over the field of view from two experiments. The western blot showing cleavage of spike is directly underneath the heatmap. (C) PV bearing BA.1, BA.2, or chimeras with Delta were transduced into either parental 293T cells or 293T cells overexpressing TMPRSS2. The fold increase of the virus entry in TMPRSS2-overexpressing cells over parental cells is shown above the scatterplots. (legend continued on next page)

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-ACE2 antibody R&D systems Cat#AF933; RRID:AB_355722 Rabbit anti-SARS-CoV-2 S Thermofisher Cat#PA1-41165; RRID:AB_1087210 Mouse anti-SARS-CoV-2 S1 R&D systems Cat#MAB105403 Mouse anti HIV-1 p55/p24 NIBSC Cat#ARP313 Rabbit anti-GAPDH Proteintech Cat#10494-1-AP; RRID:AB_2263076 Anti-rabbit HRP conjugate Cell Signaling Cat#7074; RRID:AB_2099233 Anti-mouse HRP conjugate Cell Signaling Cat#7076; RRID:AB_330924 Goat anti-Rabbit IgG Alexa Fluor 647 Thermofisher Cat#A21244; RRID:AB_2535812 Bacterial and virus strains XL1-blue cells Agilent Cat#200249 Biological samples Airway organoids Joo-Hyeon Lee N/A Human Sera Collier et al. (2021a) N/A Chemicals, peptides, and recombinant proteins E64D Tocris Cat#4545 Camostat Sigma-Aldrich Cat#SML0057 Fugene HD Transfection Reagent Promega Cat#E2311 Fugene 6 Transfection Reagent Promega Cat#E2691 Critical commercial assays Bright-Glo Promega Cat#E2650 QuikChange Lightning Agilent Cat#210518 QuantiTect SYBR Green PCR Kit Qiagen Cat#204143 Experimental models: Cell lines HEK293T ATCC Cat#CRL-3216 HEK293T-TMPRSS2 Leo James N/A HEK293T-ACE2DTMPRSS2 Leo James N/A HEK293T-GFP11 Leo James N/A Vero-GFP1-10 Leo James N/A Vero-ACE2/TMPRSS2 Emma Thomson N/A Calu3 Paul Lehner N/A A549-ACE2/TMPRSS2 Massimo Palmarini N/A NCI-H1299 Simon Cook N/A HeLa-ACE2 James Voss N/A Oligonucleotides SARS-CoV-2_Delta_G156E_Fwd: AG CTGGATGGAAAGCGAGGTGTACAG CAGCGCCAACAACTG This paper N/A SARS-CoV-2_Delta_G156E_Rev: GC AGTTGTTGGCGCTGCTGTACACCT CGCTTTCCATCCAGCT This paper N/A SARS-CoV-2_Delta_D142G_Fwd: G CAACGACCCCTTCCTGGGCGTCTA CTACCACAAGAAC This paper N/A (Continued on next page) Cell Reports 40, 111220, August 16, 2022 e1

Techniques: Transduction, Expressing, Western Blot, Virus

Journal: Microbiology Spectrum

Article Title: Seasonal human coronaviruses OC43, 229E, and NL63 induce cell surface modulation of entry receptors and display host cell-specific viral replication kinetics

doi: 10.1128/spectrum.04220-23

Figure Lengend Snippet: Susceptibility of various cell lines to CPE following infection by HCoVs

Article Snippet: The following antibodies and isotypes were used to quantify the surface marker expression and receptor modulation in the uninfected (control) and infected cells: PE anti-human CD13, anti-human CD147 (isotype-control antibody mouse IgG1 κ, BioLegend); and anti-human CD326 (isotype-control antibody mouse IgG2a κ; BioLegend); human anti-ACE2 antibody (isotype-control antibody Goat IgG; R&D Systems) and anti-GD3, 9-O-acetyl (clone UM4D4; isotype-control antibody mouse IgM κ; Millipore Sigma).

Techniques: Infection

Journal: Microbiology Spectrum

Article Title: Seasonal human coronaviruses OC43, 229E, and NL63 induce cell surface modulation of entry receptors and display host cell-specific viral replication kinetics

doi: 10.1128/spectrum.04220-23

Figure Lengend Snippet: Phenotypic characterization of cell surface markers of OC43-infected cells. Phenotypic characterization of ( A ) uninfected (blue) and ( B ) OC43-infected HCT-8 cells (red). CD13, CD147, CD326, ACE2, and GD3 expression were probed by flow cytometry. ( C ) Histogram plots of control and infected HCT-8 cells relative to isotype control (gray). Histograms plots showing ( D ) percentage of cells expressing a given marker and ( E ) mean fluorescence intensity. Data in panels D and E represent the mean of two biological replicates for all antigens except GD3, where three biological replicates were carried out. Statistical analysis was performed with the multiple unpaired t -test with Welch’s correction. Only results that reached statistical significance were identified: * P ≤ 0.033, ** P ≤ 0.002, *** P ≤ 0.0001, **** P ≤ 0.0001.

Article Snippet: The following antibodies and isotypes were used to quantify the surface marker expression and receptor modulation in the uninfected (control) and infected cells: PE anti-human CD13, anti-human CD147 (isotype-control antibody mouse IgG1 κ, BioLegend); and anti-human CD326 (isotype-control antibody mouse IgG2a κ; BioLegend); human anti-ACE2 antibody (isotype-control antibody Goat IgG; R&D Systems) and anti-GD3, 9-O-acetyl (clone UM4D4; isotype-control antibody mouse IgM κ; Millipore Sigma).

Techniques: Infection, Expressing, Flow Cytometry, Control, Marker, Fluorescence

Journal: Microbiology Spectrum

Article Title: Seasonal human coronaviruses OC43, 229E, and NL63 induce cell surface modulation of entry receptors and display host cell-specific viral replication kinetics

doi: 10.1128/spectrum.04220-23

Figure Lengend Snippet: Phenotypic characterization of cell surface markers of 229E-infected cells. Phenotypic characterization of ( A ) uninfected (blue) and ( B ) 229E-infected MRC-5 cells (red). CD13, CD147, CD326, and ACE2 expression were probed by flow cytometry. ( C ) Histogram plots of control and infected MRC-5 cells relative to isotype control (gray). Histograms plots showing ( D ) percentage of cells expressing a given marker and ( E ) mean fluorescence intensity. Data in panels D and E represent the mean of three biological replicates, except for CD147 where two biological replicates were carried out. Statistical analysis was performed with the multiple unpaired t -test with Welch’s correction. Only results that reached statistical significance were identified: * P ≤ 0.033, ** P ≤ 0.002, *** P ≤ 0.0001, **** P ≤ 0.0001.

Article Snippet: The following antibodies and isotypes were used to quantify the surface marker expression and receptor modulation in the uninfected (control) and infected cells: PE anti-human CD13, anti-human CD147 (isotype-control antibody mouse IgG1 κ, BioLegend); and anti-human CD326 (isotype-control antibody mouse IgG2a κ; BioLegend); human anti-ACE2 antibody (isotype-control antibody Goat IgG; R&D Systems) and anti-GD3, 9-O-acetyl (clone UM4D4; isotype-control antibody mouse IgM κ; Millipore Sigma).

Techniques: Infection, Expressing, Flow Cytometry, Control, Marker, Fluorescence

Journal: Microbiology Spectrum

Article Title: Seasonal human coronaviruses OC43, 229E, and NL63 induce cell surface modulation of entry receptors and display host cell-specific viral replication kinetics

doi: 10.1128/spectrum.04220-23

Figure Lengend Snippet: Phenotypic characterization of cell surface markers of NL63-infected cells. Phenotypic characterization of ( A ) uninfected (blue) and ( B ) NL63-infected LLC-MK2 cells (red). CD13, CD147, CD326, and ACE2 expression were probed by flow cytometry. ( C ) Histogram plots of control and infected LLC-MK2 cells relative to isotype control (gray). Histograms plots showing ( D ) percentage of cells expressing a given marker and ( E ) mean fluorescence intensity. Data in panels D and E represent the mean of three biological replicates, except for CD13 where two biological replicates were carried out. Statistical analysis was performed with the multiple unpaired t -test with Welch’s correction. Only results that reached statistical significance were identified: * P ≤ 0.033, ** P ≤ 0.002, *** P ≤ 0.0001, **** P ≤ 0.0001.

Article Snippet: The following antibodies and isotypes were used to quantify the surface marker expression and receptor modulation in the uninfected (control) and infected cells: PE anti-human CD13, anti-human CD147 (isotype-control antibody mouse IgG1 κ, BioLegend); and anti-human CD326 (isotype-control antibody mouse IgG2a κ; BioLegend); human anti-ACE2 antibody (isotype-control antibody Goat IgG; R&D Systems) and anti-GD3, 9-O-acetyl (clone UM4D4; isotype-control antibody mouse IgM κ; Millipore Sigma).

Techniques: Infection, Expressing, Flow Cytometry, Control, Marker, Fluorescence

Journal: Microbiology Spectrum

Article Title: Seasonal human coronaviruses OC43, 229E, and NL63 induce cell surface modulation of entry receptors and display host cell-specific viral replication kinetics

doi: 10.1128/spectrum.04220-23

Figure Lengend Snippet: Soluble ACE2 protein and anti-ACE2 monoclonal blocking antibody inhibit NL63 infection in LLC-MK2 cells. ( A ) Treatment with soluble ACE2 or control protein ovalbumin at 5 and 10 mg/mL was pre-incubated with NL63 virus at MOI 0.1 (virus titer: 8.89 × 10 5 TCID 50 /mL) for 1 hour, and the protein and virus mixture complex was added to the LLC-MK2 cells. ( B ) Similarly, cells were incubated for 1 hour with human anti-ACE2 monoclonal blocking antibody (10, 40, and 120 µg/mL) or unrelated control antibody (anti-DC-SIGN; 40 µg/mL) followed by addition of NL63 virus (MOI 0.1). Five days post-infection, both culture supernatants and cell lysates were harvested for quantification of nucleocapsid (N) and spike (S) vRNA copies by ddPCR. Percent relative viral inhibition following treatment with (C) sACE2 or (D) anti-ACE2 monoclonal antibody compared to their respective untreated control. Data represent three biological replicates for sACE2 or four (anti-ACE2) with three technical replicates per experiment. Statistical analysis was performed using an unpaired t -test with Welch’s correction ( P < 0.05) relative to untreated control. n.s. denoted as no statistical difference; * P ≤ 0.033, ** P ≤ 0.002, *** P ≤ 0.0001, **** P ≤ 0.0001.

Article Snippet: The following antibodies and isotypes were used to quantify the surface marker expression and receptor modulation in the uninfected (control) and infected cells: PE anti-human CD13, anti-human CD147 (isotype-control antibody mouse IgG1 κ, BioLegend); and anti-human CD326 (isotype-control antibody mouse IgG2a κ; BioLegend); human anti-ACE2 antibody (isotype-control antibody Goat IgG; R&D Systems) and anti-GD3, 9-O-acetyl (clone UM4D4; isotype-control antibody mouse IgM κ; Millipore Sigma).

Techniques: Blocking Assay, Infection, Control, Incubation, Virus, Inhibition